I'm Humanity [ATATCCGGGAATTGATATGTACAATTTCGGATAGGCCCATTAATGGATTAACAATGAATTTCGGACCTACGCAGGCTAAA]

Map DNA

Which skills this map tests, measured from the map file.

hardest moment 12 notes on screen · 77% of the map

harder than 100%

hardest moment 21 notes in a row · 8% of the map

harder than 88%

hardest moment 129 BPM (1/4) · 8% of the map

harder than 68%

237 sliders · 28% of the map

harder than 63%

hardest moment 1756 px/s · 17% of the map

harder than 44%

hardest moment 161 BPM (1/4) · 24% of the map

harder than 44%

hardest moment 1456 px/s · 12% of the map

harder than 32%

hardest moment 1283 px/s · 13% of the map

harder than 29%

hardest moment 54.4 px radius · 42% of the map

harder than 0%

Measured from the map file, no mods. Compared with 20,298 analysed maps across every star range. How

Maps like this

Closest note patterns among every analysed map (other difficulties of this set left out).

How this map fits you

Compared with the weighted levels of your top plays, in the same units. No mods applied.

Log in with osu! to see how this map compares with what your top plays show.

Mod breakdown

Accuracy distribution

No data